TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00070

sequenceLengthmiRNA familysRNA IDtarget
UGUGGGUGGGGUGGAAAGAUU21miR5301 S24121304click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 406 39.56
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 732 97.02
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 4998 583.88
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 900 193.81
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 2521 185.95
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 35 26.97
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 37 28.07
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 25 17.81
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 27 19.88
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 42 26.23
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 23 14.65
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 51 33.61
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 43 26.29
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 26 15.56
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 9 8.78
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 27 15.76
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 22 21.58
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 33 23.34
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 31 33.75
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 49 46.82
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 23 66.44
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 47 32.74
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 63 84.07
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 21 8.78
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 7 7.16
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 37 9.31
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 33 9.35
S0712 Solanum lycopersicum MicroTom fruit , mature green 70 17.91
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 111 53.47
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 49 40.71
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 93 52.73
S0708 Solanum lycopersicum MicroTom flower, open 18 5.55
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 32 8.4
S0373 Solanum lycopersicum Heinz 1706 fruit 6 1.8
S0372 Solanum lycopersicum Heinz 1706 flower 7 2.12
S0371 Solanum lycopersicum Heinz 1706 leaf 10 3.01

Hits on known miRNAs

hit miRNAalignment
sly-miR5301TGTGGGTGGGGTGGAAAGATT
|||||||||||||||||||||
TGTGGGTGGGGTGGAAAGATT

Precursor of miRNA M00070

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch04 55142268 55142336 + UGUGGGUGGGGUGGAAAGAU
UUGAUAAAUCUAAUUUUAAA
GAGAUUAAAUCUUUCCUACU
CCUCCCAUA		 -34.10 miRNA* structure