Tomato sRNA S24121304
| Sequence | Length | annotation |
| UGUGGGUGGGGUGGAAAGAUU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
406 |
39.56 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
732 |
97.02 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
4998 |
583.88 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
900 |
193.81 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2521 |
185.95 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
35 |
26.97 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
37 |
28.07 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
25 |
17.81 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
27 |
19.88 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
42 |
26.23 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
23 |
14.65 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
51 |
33.61 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
43 |
26.29 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
26 |
15.56 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
9 |
8.78 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
27 |
15.76 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
22 |
21.58 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
33 |
23.34 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
31 |
33.75 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
49 |
46.82 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
23 |
66.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
47 |
32.74 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
63 |
84.07 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
21 |
8.78 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
7 |
7.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
37 |
9.31 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
33 |
9.35 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
70 |
17.91 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
111 |
53.47 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
49 |
40.71 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
93 |
52.73 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
18 |
5.55 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
32 |
8.4 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
6 |
1.8 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
7 |
2.12 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
10 |
3.01 |
|