TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00079

sequenceLengthmiRNA familysRNA IDtarget
UGUCGCAGAUGACUUUCGC19NA S24047117click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 4 0.39
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 5 0.66
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 7 0.52
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 72 55.48
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 61 46.27
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 51 36.33
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 60 44.19
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 63 39.34
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 83 52.87
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 55 36.25
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 46 28.12
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 62 37.11
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 252 245.88
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 373 217.75
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 211 206.98
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 478 338.06
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 110 119.75
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 142 135.67
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 32 92.44
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 55 38.32
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 7 9.34
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 1 0.42
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 18 4.53
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 2 0.57
S0712 Solanum lycopersicum MicroTom fruit , mature green 22 5.63
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 54 26.01
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 8 6.65
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 8 4.54
S0708 Solanum lycopersicum MicroTom flower, open 11 3.39
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 31 8.14
S0373 Solanum lycopersicum Heinz 1706 fruit 2 0.6
S0372 Solanum lycopersicum Heinz 1706 flower 3 0.91
S0371 Solanum lycopersicum Heinz 1706 leaf 9 2.71

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00079

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch08 53776411 53776495 + UGUCGCAGAUGACUUUCGCC
CAUUUAUAGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA
-37.30 NA structure
SL2.40ch08 53789929 53790013 + UGUCGCAGAUGACUUUCGCC
CAUUUAUGGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA
-38.30 NA structure
SL2.40ch12 6988968 6988874 - UGUCGCAGAUGACUUUCGCC
CUUCUAAGGAACCACACUUU
CUGUAAAUCUAAUUAAUUUG
AAUUCAAUGUGGCAGGACGA
GAGUCAUCUGUGACA
-37.34 NA structure