Tomato miRNA M00079
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
4 |
0.39 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
5 |
0.66 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
7 |
0.52 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
72 |
55.48 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
61 |
46.27 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
51 |
36.33 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
60 |
44.19 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
63 |
39.34 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
83 |
52.87 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
55 |
36.25 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
46 |
28.12 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
62 |
37.11 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
252 |
245.88 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
373 |
217.75 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
211 |
206.98 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
478 |
338.06 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
110 |
119.75 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
142 |
135.67 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
32 |
92.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
55 |
38.32 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
7 |
9.34 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
18 |
4.53 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
2 |
0.57 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
22 |
5.63 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
54 |
26.01 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
8 |
6.65 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
8 |
4.54 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
11 |
3.39 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
31 |
8.14 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
9 |
2.71 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00079
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch08 |
53776411 |
53776495 |
+ |
UGUCGCAGAUGACUUUCGCC
CAUUUAUAGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA |
-37.30 |
NA |
structure |
| SL2.40ch08 |
53789929 |
53790013 |
+ |
UGUCGCAGAUGACUUUCGCC
CAUUUAUGGAACCACACUUU
CUUUAAUUUGAAUUCUAUGU
GGUAGGACGAGAGUCAUCUG
UGACA |
-38.30 |
NA |
structure |
| SL2.40ch12 |
6988968 |
6988874 |
- |
UGUCGCAGAUGACUUUCGCC
CUUCUAAGGAACCACACUUU
CUGUAAAUCUAAUUAAUUUG
AAUUCAAUGUGGCAGGACGA
GAGUCAUCUGUGACA |
-37.34 |
NA |
structure |
|