TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00085

sequenceLengthmiRNA familysRNA IDtarget
UUUGGCUCAUGGAUUUUAGC20NA S26404271click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 7762 756.37
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 661 87.61
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 1166 136.21
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 2012 433.27
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 10 0.74
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 5 3.85
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 2 1.52
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 8 5.7
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 5 3.12
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 3 1.91
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 3 1.98
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 4 2.45
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 6 3.59
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 2 1.17
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 3 2.94
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 5 3.54
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 5 5.44
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 4 3.82
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 2 5.78
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 8 5.57
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 4 1.67
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 5 1.26
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 3 0.85
S0712 Solanum lycopersicum MicroTom fruit , mature green 4 1.02
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 3 1.45
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 1 0.83
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 1 0.57
S0373 Solanum lycopersicum Heinz 1706 fruit 48 14.37
S0372 Solanum lycopersicum Heinz 1706 flower 19 5.75
S0371 Solanum lycopersicum Heinz 1706 leaf 10 3.01

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00085

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch08 393655 393849 + GCUGAAAUCCAUGAGCCUAA
ACUAUAGCCCUCGCCUUUGG
CAUGGUUGCAUACAAAUAUU
GUGGUGAUAAGGUCCAACUC
AAUUUUCUAUUUUCCCAAUC
ACGUGCACACAAAAACCAAG
CUGGCUCUAGUUAUUUAAUG
ACACACAGUGAGUGGAGUUC
AAGAGAGGGCUACAGUUUGG
CUCAUGGAUUUUAGC
-73.21 NA structure