Tomato sRNA S26404271
| Sequence | Length | annotation |
| UUUGGCUCAUGGAUUUUAGC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
7762 |
756.37 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
661 |
87.61 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1166 |
136.21 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2012 |
433.27 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
10 |
0.74 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
5 |
3.85 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
2 |
1.52 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
8 |
5.7 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
5 |
3.12 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
3 |
1.91 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
3 |
1.98 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
4 |
2.45 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
6 |
3.59 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
2 |
1.17 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
3 |
2.94 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
5 |
3.54 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
5 |
5.44 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
4 |
3.82 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
2 |
5.78 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
8 |
5.57 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
5 |
1.26 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
3 |
0.85 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
4 |
1.02 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
48 |
14.37 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
19 |
5.75 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
10 |
3.01 |
|