TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00092

sequenceLengthmiRNA familysRNA IDtarget
CAUGGCAGGAAGACAUGAGGC21NA S13318185NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 34 3.31
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 14 1.86
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 3 0.35
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1 0.22
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 135 104.03
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 52 39.45
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 54 38.47
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 103 75.86
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 106 66.19
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 106 67.53
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 56 36.91
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 59 36.07
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 81 48.49
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 62 60.49
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 172 100.41
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 134 131.45
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 126 89.11
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 29 31.57
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 1 2.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 76 52.94
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 105 140.12
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 7 2.93
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3 3.07
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 16 4.03
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 3 0.85
S0712 Solanum lycopersicum MicroTom fruit , mature green 16 4.09
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 82 39.5
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 85 70.61
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 51 28.92
S0708 Solanum lycopersicum MicroTom flower, open 16 4.94
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 64 16.8
S0372 Solanum lycopersicum Heinz 1706 flower 3 0.91

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00092

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch04 4907566 4907643 + CAUGGCAGGAAGACAUGAGG
C
AUUAGUAUGUAUAUUGUGU
AAAUUUUAAAUACUAAUGCC
UCAUGCCUUCCUGCCAUG
-48.40 NA structure