Tomato sRNA S13318185
| Sequence | Length | annotation |
| CAUGGCAGGAAGACAUGAGGC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
34 |
3.31 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
14 |
1.86 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
135 |
104.03 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
52 |
39.45 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
54 |
38.47 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
103 |
75.86 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
106 |
66.19 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
106 |
67.53 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
56 |
36.91 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
59 |
36.07 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
81 |
48.49 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
62 |
60.49 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
172 |
100.41 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
134 |
131.45 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
126 |
89.11 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
29 |
31.57 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1 |
2.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
76 |
52.94 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
105 |
140.12 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
16 |
4.03 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
3 |
0.85 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
16 |
4.09 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
82 |
39.5 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
85 |
70.61 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
51 |
28.92 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
16 |
4.94 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
64 |
16.8 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
S13318185 mapped to the following genes
|