TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00100

sequenceLengthmiRNA familysRNA IDtarget
AUGGCAGGAAGACAUGAGGCA21NA S11184965click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 1 0.1
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 3 0.65
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 2 0.15
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 223 171.85
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 148 112.27
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 123 87.63
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 190 139.93
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 318 198.56
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 313 199.39
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 133 87.65
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 184 112.49
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 155 92.79
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 141 137.57
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 379 221.25
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 202 198.15
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 383 270.87
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 89 96.89
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 2 1.91
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 1 2.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 187 130.27
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 121 161.47
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 17 7.11
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 16 16.36
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 51 12.84
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 44 12.47
S0712 Solanum lycopersicum MicroTom fruit , mature green 70 17.91
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 386 185.94
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 175 145.38
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 383 217.16
S0708 Solanum lycopersicum MicroTom flower, open 53 16.35
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 218 57.23
S0373 Solanum lycopersicum Heinz 1706 fruit 3 0.9
S0372 Solanum lycopersicum Heinz 1706 flower 13 3.93
S0371 Solanum lycopersicum Heinz 1706 leaf 3 0.9

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00100

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch04 4907567 4907642 + AUGGCAGGAAGACAUGAGGC
AUUAGUAUGUAUAUUGUGUA
AAUUUUAAAUACUAAUGCCU
CAUGCCUUCCUGCCAU		 -45.80 NA structure