Tomato sRNA S11184965
| Sequence | Length | annotation |
| AUGGCAGGAAGACAUGAGGCA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2 |
0.15 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
223 |
171.85 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
148 |
112.27 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
123 |
87.63 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
190 |
139.93 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
318 |
198.56 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
313 |
199.39 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
133 |
87.65 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
184 |
112.49 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
155 |
92.79 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
141 |
137.57 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
379 |
221.25 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
202 |
198.15 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
383 |
270.87 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
89 |
96.89 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
2 |
1.91 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1 |
2.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
187 |
130.27 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
121 |
161.47 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
17 |
7.11 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
16 |
16.36 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
51 |
12.84 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
44 |
12.47 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
70 |
17.91 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
386 |
185.94 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
175 |
145.38 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
383 |
217.16 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
53 |
16.35 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
218 |
57.23 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3 |
0.9 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
13 |
3.93 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3 |
0.9 |
S11184965 mapped to the following genes
|