 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00114
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| UGUCGCAGAUGACUUUCGCCC | 21 | NA | S24047119 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4621 | 450.29 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3515 | 465.9 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 288 | 33.64 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 393 | 84.63 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3121 | 230.2 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 1447 | 1115.08 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 683 | 518.13 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 566 | 403.24 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 551 | 405.8 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 753 | 470.18 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1157 | 737.06 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 914 | 602.37 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 943 | 576.5 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 950 | 568.68 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 6214 | 6063 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 11399 | 6654.43 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6620 | 6493.79 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 13086 | 9254.85 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 3502 | 3812.29 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3986 | 3808.45 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 418 | 1207.49 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1245 | 867.32 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 269 | 358.96 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 71 | 29.69 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 9 | 9.2 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 174 | 43.8 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 48 | 13.6 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 200 | 51.17 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 180 | 86.71 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 46 | 38.21 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 61 | 34.59 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 286 | 88.24 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 564 | 148.07 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1368 | 409.46 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 908 | 274.8 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1057 | 318.52 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00114
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch08 | 53776411 | 53776495 | + | UGUCGCAGAUGACUUUCGCC CAUUUAUAGAACCACACUUU CUUUAAUUUGAAUUCUAUGU GGUAGGACGAGAGUCAUCUG UGACA |
-37.30 | NA | structure |
| SL2.40ch12 | 6988968 | 6988874 | - | UGUCGCAGAUGACUUUCGCC CUUCUAAGGAACCACACUUU CUGUAAAUCUAAUUAAUUUG AAUUCAAUGUGGCAGGACGA GAGUCAUCUGUGACA |
-37.34 | NA | structure |
