Tomato sRNA S24047119
| Sequence | Length | annotation |
| UGUCGCAGAUGACUUUCGCCC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
4621 |
450.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3515 |
465.9 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
288 |
33.64 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
393 |
84.63 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3121 |
230.2 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
1447 |
1115.08 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
683 |
518.13 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
566 |
403.24 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
551 |
405.8 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
753 |
470.18 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
1157 |
737.06 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
914 |
602.37 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
943 |
576.5 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
950 |
568.68 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
6214 |
6063 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
11399 |
6654.43 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6620 |
6493.79 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
13086 |
9254.85 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
3502 |
3812.29 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
3986 |
3808.45 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
418 |
1207.49 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
1245 |
867.32 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
269 |
358.96 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
71 |
29.69 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
9 |
9.2 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
174 |
43.8 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
48 |
13.6 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
200 |
51.17 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
180 |
86.71 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
46 |
38.21 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
61 |
34.59 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
286 |
88.24 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
564 |
148.07 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1368 |
409.46 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
908 |
274.8 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1057 |
318.52 |
|