Tomato miRNA M00133
| sequence | Length | miRNA family | sRNA ID | target |
| UUACUACGGUCAGGAAUCUUAU | 22 | NA |
S24536112 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
254 |
24.75 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
52 |
6.89 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
330 |
38.55 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
109 |
23.47 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
13905 |
1025.63 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
19 |
7.95 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
29 |
7.3 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
9 |
2.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
38 |
9.72 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
7 |
3.97 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
53 |
16.35 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
11 |
2.89 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
932 |
278.96 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
354 |
107.14 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
783 |
235.95 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00133
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch12 |
64810805 |
64810653 |
- |
AUAAGAUCUUUUACCGUAGU
AAUCACAAAUCCUAGACGAC
UGUGCUCUUGGACAGAAAUU
UCUGAUCAAAGCAUUUCCCU
UCUUAAAUUCAAGAGAAUGC
UUACAGUAGGUCCCUCAUCG
AGUGUUUGUGAUUACUACGG
UCAGGAAUCUUAU |
-52.40 |
NA |
structure |
|