Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUACUACGGUCAGGAAUCUUAU	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	254	24.75
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	52	6.89
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	330	38.55
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	109	23.47
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	13905	1025.63
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	19	7.95
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	2	2.05
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	29	7.3
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	9	2.55
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	38	9.72
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	3	1.45
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	2	1.66
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	7	3.97
S0708	Solanum lycopersicum	MicroTom	flower, open	53	16.35
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	11	2.89
S0373	Solanum lycopersicum	Heinz 1706	fruit	932	278.96
S0372	Solanum lycopersicum	Heinz 1706	flower	354	107.14
S0371	Solanum lycopersicum	Heinz 1706	leaf	783	235.95