 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00142
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| GGCAGAGACAAUACCUGAAUAUG | 23 | NA | S18019913 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 4 | 0.53 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 8 | 0.59 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 17 | 13.1 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 17 | 12.9 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 7 | 5.16 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 16 | 10.19 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 12 | 7.91 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 15 | 9.17 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 11 | 6.58 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 97 | 94.64 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 72 | 42.03 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 142 | 139.29 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 79 | 55.87 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 76 | 82.73 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 115 | 109.88 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 25 | 72.22 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 13 | 9.06 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 4 | 5.34 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 13 | 5.44 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 13 | 3.68 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 28 | 7.16 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 9 | 2.78 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 13 | 3.41 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00142
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 49238939 | 49238751 | - | CAUACUCAGGUAUUGUCUCU GCCAUGGGCGGCCAUUCGCU CUUUUAAUCCCCUCUUAUUG GCUCGCAGCCUCAAGGGAGA AUCGAACCCGUGACCUAUGG CUCCUUUACAUUCCCUUGAG GCAGCAAGCCAAUAAGAGGG GAUUAAAAGAGCGAAUGGCC GCCAAUGGCAGAGACAAUAC CUGAAUAUG |
-143.57 | NA | structure |
