TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S18019913

SequenceLengthannotation
GGCAGAGACAAUACCUGAAUAUG23miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 2 0.19
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 4 0.53
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 3 0.35
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 8 0.59
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 17 13.1
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 17 12.9
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 7 4.99
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 7 5.16
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 8 5
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 16 10.19
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 12 7.91
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 15 9.17
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 11 6.58
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 97 94.64
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 72 42.03
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 142 139.29
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 79 55.87
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 76 82.73
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 115 109.88
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 25 72.22
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 13 9.06
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 4 5.34
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 13 5.44
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 11 2.77
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 13 3.68
S0712 Solanum lycopersicum MicroTom fruit , mature green 28 7.16
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 2 0.96
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 3 2.49
S0708 Solanum lycopersicum MicroTom flower, open 9 2.78
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 13 3.41
S0373 Solanum lycopersicum Heinz 1706 fruit 2 0.6

S18019913 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc05g031610 3 25 + click here