Tomato sRNA S18019913
| Sequence | Length | annotation |
| GGCAGAGACAAUACCUGAAUAUG | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
2 |
0.19 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
4 |
0.53 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
8 |
0.59 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
17 |
13.1 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
17 |
12.9 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
7 |
4.99 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
7 |
5.16 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
8 |
5 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
16 |
10.19 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
12 |
7.91 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
15 |
9.17 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
11 |
6.58 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
97 |
94.64 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
72 |
42.03 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
142 |
139.29 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
79 |
55.87 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
76 |
82.73 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
115 |
109.88 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
25 |
72.22 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
13 |
9.06 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
4 |
5.34 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
13 |
5.44 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
11 |
2.77 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
13 |
3.68 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
28 |
7.16 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
9 |
2.78 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
13 |
3.41 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
S18019913 mapped to the following genes
|