Tomato miRNA M00145
| sequence | Length | miRNA family | sRNA ID | target |
| UGAACCUGCAUCGUGAUGGCCUG | 23 | NA |
S22951928 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
23 |
2.24 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
7 |
0.93 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
23 |
2.69 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3586 |
264.5 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
88 |
36.8 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
58 |
59.31 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
88 |
22.15 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
247 |
70.01 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
216 |
55.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
20 |
9.63 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
17 |
14.12 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
33 |
18.71 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
90 |
27.77 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
184 |
48.3 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
832 |
249.03 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
460 |
139.22 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
768 |
231.43 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00145
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
61427691 |
61427824 |
+ |
UGAACCUGCAUCGUGAUGGC
CUGUGCCAUCUGGGUUAGAG
AUGCUCUCACCUCAAAUCAG
AAUAAUAAGUCCACAUCAAC
CAUAUUAAGGGCAUCUCUAG
CCCAGAUGGCACAUGCCAUC
ACGAUGUAGGCUCA |
-83.00 |
NA |
structure |
|