Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGAACCUGCAUCGUGAUGGCCUG	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	23	2.24
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	7	0.93
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	23	2.69
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	3586	264.5
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	88	36.8
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	58	59.31
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	88	22.15
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	247	70.01
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	216	55.26
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	20	9.63
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	17	14.12
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	33	18.71
S0708	Solanum lycopersicum	MicroTom	flower, open	90	27.77
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	184	48.3
S0373	Solanum lycopersicum	Heinz 1706	fruit	832	249.03
S0372	Solanum lycopersicum	Heinz 1706	flower	460	139.22
S0371	Solanum lycopersicum	Heinz 1706	leaf	768	231.43