TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00146

sequenceLengthmiRNA familysRNA IDtarget
UGUGGGGAAGAAGGGCAUUUUGG23NA S24119683click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 2 0.19
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 10 1.33
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 8 0.93
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 3 0.65
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 48 3.54
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 79 60.88
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 18 13.65
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 47 33.48
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 53 39.03
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 51 31.84
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 48 30.58
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 64 42.18
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 60 36.68
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 77 46.09
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 37 36.1
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 27 15.76
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 23 22.56
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 44 31.12
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 24 26.13
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 11 10.51
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 3 8.67
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 19 13.24
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 42 56.05
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 23 9.62
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3 3.07
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 91 22.91
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 167 47.33
S0712 Solanum lycopersicum MicroTom fruit , mature green 54 13.82
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 113 54.43
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 278 230.95
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 474 268.76
S0708 Solanum lycopersicum MicroTom flower, open 32 9.87
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 67 17.59
S0372 Solanum lycopersicum Heinz 1706 flower 1 0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00146

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch02 45483356 45483477 + GUAAAGUGUCCUUCUUGUCC
GCAUUUGUAGCAUCCCGCUC
CUCCUCCACCGCCUCCUUGG
CUACAUUCCCUUGUGAAAGA
AGGAAGGGGCUGCUACAAAU
GUGGGGAAGAAGGGCAUUUU
GG
-64.00 NA structure
SL2.40ch02 45487053 45487174 + GUAAAGUGUCCCUCUUCGCC
GCAUUUGUAGCAUCCCGCUA
UUCCUCCACCGCCUCCCUGG
CUACAUUCCCUUGCGAAAGA
AGGAGGGGGCUGCUACAAAU
GUGGGGAAGAAGGGCAUUUU
GG
-63.50 NA structure