Tomato sRNA S24119683
| Sequence | Length | annotation |
| UGUGGGGAAGAAGGGCAUUUUGG | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
2 |
0.19 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
10 |
1.33 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
48 |
3.54 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
79 |
60.88 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
18 |
13.65 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
47 |
33.48 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
53 |
39.03 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
51 |
31.84 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
48 |
30.58 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
64 |
42.18 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
60 |
36.68 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
77 |
46.09 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
37 |
36.1 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
27 |
15.76 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
23 |
22.56 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
44 |
31.12 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
24 |
26.13 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
11 |
10.51 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
3 |
8.67 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
19 |
13.24 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
42 |
56.05 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
23 |
9.62 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
91 |
22.91 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
167 |
47.33 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
54 |
13.82 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
113 |
54.43 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
278 |
230.95 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
474 |
268.76 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
32 |
9.87 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
67 |
17.59 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|