 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00158
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AGAGGACGGUCUGAGAGAGUUUUA | 24 | NA | S06611281 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 33 | 25.43 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 18 | 13.65 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 46 | 32.77 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 51 | 37.56 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 34 | 21.23 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 35 | 22.3 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 44 | 29 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 44 | 26.9 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 47 | 28.13 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 9 | 8.78 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 15 | 8.76 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 17 | 16.68 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 3 | 2.12 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 30 | 32.66 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 11 | 10.51 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 125 | 87.08 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 88 | 117.43 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 44 | 18.4 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 33 | 33.74 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 103 | 25.93 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 178 | 50.45 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 97 | 24.82 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 80 | 38.54 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 65 | 54 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 35 | 19.85 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 50 | 15.43 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 140 | 36.75 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00158
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 41557609 | 41557470 | - | UAAAACUCUCUCAGACCGUC CUCUAAGCAUAUAAUGUCAU AUUGGCUUCAAAGAGACCAC UGAAAAUCUUUUGCAACCAU AAAGAGAAAUAUAUAUAUAU AUAUAUAUAUACGCUUAGAG GACGGUCUGAGAGAGUUUUA |
-64.20 | NA | structure |
