Tomato sRNA S06611281
| Sequence | Length | annotation |
| AGAGGACGGUCUGAGAGAGUUUUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2 |
0.15 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
33 |
25.43 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
18 |
13.65 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
46 |
32.77 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
51 |
37.56 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
34 |
21.23 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
35 |
22.3 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
44 |
29 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
44 |
26.9 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
47 |
28.13 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
9 |
8.78 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
15 |
8.76 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
17 |
16.68 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
3 |
2.12 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
30 |
32.66 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
11 |
10.51 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
125 |
87.08 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
88 |
117.43 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
44 |
18.4 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
33 |
33.74 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
103 |
25.93 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
178 |
50.45 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
97 |
24.82 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
80 |
38.54 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
65 |
54 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
35 |
19.85 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
50 |
15.43 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
140 |
36.75 |
|