TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00167

sequenceLengthmiRNA familysRNA IDtarget
UGGGCAGCGAACCGGAACUACGAG24NA S23805755NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 22 2.14
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 9 1.19
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 8 0.93
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 39 8.4
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 3 0.22
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 175 134.86
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 9 6.83
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 90 64.12
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 110 81.01
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 140 87.42
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 61 38.86
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 54 35.59
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 89 54.41
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 116 69.44
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 10 9.76
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 20 11.68
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 13 12.75
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 20 14.14
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 58 63.14
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 3 8.67
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 100 69.66
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 105 140.12
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 9 3.76
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 7 7.16
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 11 2.77
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 35 9.92
S0712 Solanum lycopersicum MicroTom fruit , mature green 18 4.61
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 31 14.93
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 24 19.94
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 22 12.47
S0708 Solanum lycopersicum MicroTom flower, open 14 4.32
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 23 6.04
S0373 Solanum lycopersicum Heinz 1706 fruit 1 0.3
S0372 Solanum lycopersicum Heinz 1706 flower 1 0.3
S0371 Solanum lycopersicum Heinz 1706 leaf 2 0.6

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00167

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch08 54874177 54874098 - CUCGUAGUUUCGAUUCGCUG
UCCAGAACCAGGCUAAGAAA
AAAAAUUACCUGGUUCUGGG
CAGCGAACCGGAACUACGAG
 -56.10 NA structure