Tomato sRNA S23805755
| Sequence | Length | annotation |
| UGGGCAGCGAACCGGAACUACGAG | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
22 |
2.14 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
9 |
1.19 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
39 |
8.4 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
175 |
134.86 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
9 |
6.83 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
90 |
64.12 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
110 |
81.01 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
140 |
87.42 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
61 |
38.86 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
54 |
35.59 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
89 |
54.41 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
116 |
69.44 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
10 |
9.76 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
20 |
11.68 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
13 |
12.75 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
20 |
14.14 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
58 |
63.14 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
3 |
8.67 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
100 |
69.66 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
105 |
140.12 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
9 |
3.76 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
7 |
7.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
11 |
2.77 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
35 |
9.92 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
18 |
4.61 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
31 |
14.93 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
24 |
19.94 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
22 |
12.47 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
14 |
4.32 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
23 |
6.04 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
|