TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00169

sequenceLengthmiRNA familysRNA IDtarget
AGGCGCAUGUGUCAUAUCUUUACA24NA S07733087click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 3 0.29
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 17 2.25
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 99 11.57
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 35 7.54
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 686 50.6
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 15 11.56
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 13 9.86
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 12 8.55
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 6 4.42
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 14 8.74
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 13 8.28
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 29 19.11
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 8 4.89
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 11 6.58
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 48 46.83
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 54 31.52
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 61 59.84
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 63 44.56
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 64 69.67
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 169 161.47
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 7 20.22
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 30 20.9
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 7 9.34
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 22 9.2
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 29 7.3
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 42 11.9
S0712 Solanum lycopersicum MicroTom fruit , mature green 52 13.3
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 26 12.52
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 12 9.97
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 37 20.98
S0708 Solanum lycopersicum MicroTom flower, open 386 119.1
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 119 31.24
S0373 Solanum lycopersicum Heinz 1706 fruit 121 36.22
S0372 Solanum lycopersicum Heinz 1706 flower 148 44.79
S0371 Solanum lycopersicum Heinz 1706 leaf 31 9.34

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00169

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch09 1188165 1188098 - AGGCGCAUGUGUCAUAUCUU
UACAUGGUCUGACAUCUGAG
ACCAUGUAAGGAUAUGACAC
AUGAGCCC		 -47.50 miRNA* structure