Tomato sRNA S07733087
| Sequence | Length | annotation |
| AGGCGCAUGUGUCAUAUCUUUACA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3 |
0.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
17 |
2.25 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
99 |
11.57 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
35 |
7.54 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
686 |
50.6 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
15 |
11.56 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
13 |
9.86 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
12 |
8.55 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
6 |
4.42 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
14 |
8.74 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
13 |
8.28 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
29 |
19.11 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
8 |
4.89 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
11 |
6.58 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
48 |
46.83 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
54 |
31.52 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
61 |
59.84 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
63 |
44.56 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
64 |
69.67 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
169 |
161.47 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
7 |
20.22 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
30 |
20.9 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
7 |
9.34 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
22 |
9.2 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
29 |
7.3 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
42 |
11.9 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
52 |
13.3 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
26 |
12.52 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
12 |
9.97 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
37 |
20.98 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
386 |
119.1 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
119 |
31.24 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
121 |
36.22 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
148 |
44.79 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
31 |
9.34 |
|