 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00176
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AUGGCAGAGACAAUACCUGAGUAU | 24 | NA | S11184187 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 13 | 0.96 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 34 | 26.2 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 20 | 15.17 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 6 | 4.27 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 21 | 15.47 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 18 | 11.24 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 15 | 9.56 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 22 | 13.45 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 10 | 5.99 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 125 | 121.96 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 255 | 148.86 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 117 | 114.77 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 185 | 130.84 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 56 | 60.96 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 126 | 120.39 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 66 | 190.66 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 4 | 5.34 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 12 | 3.02 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 19 | 5.39 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 23 | 5.88 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 18 | 8.67 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 9 | 7.48 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 50 | 15.43 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 57 | 14.96 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 5 | 1.51 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00176
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 49238752 | 49238938 | + | AUAUUCAGGUAUUGUCUCUG CCAUUGGCGGCCAUUCGCUC UUUUAAUCCCCUCUUAUUGG CUUGCUGCCUCAAGGGAAUG UAAAGGAGCCAUAGGUCACG GGUUCGAUUCUCCCUUGAGG CUGCGAGCCAAUAAGAGGGG AUUAAAAGAGCGAAUGGCCG CCCAUGGCAGAGACAAUACC UGAGUAU |
-154.30 | NA | structure |
