Tomato sRNA S11184187
| Sequence | Length | annotation |
| AUGGCAGAGACAAUACCUGAGUAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
13 |
0.96 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
34 |
26.2 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
20 |
15.17 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
6 |
4.27 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
21 |
15.47 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
18 |
11.24 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
15 |
9.56 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
9 |
5.93 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
22 |
13.45 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
10 |
5.99 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
125 |
121.96 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
255 |
148.86 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
117 |
114.77 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
185 |
130.84 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
56 |
60.96 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
126 |
120.39 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
66 |
190.66 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
4 |
2.79 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
4 |
5.34 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
12 |
3.02 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
19 |
5.39 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
23 |
5.88 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
18 |
8.67 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
9 |
7.48 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
50 |
15.43 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
57 |
14.96 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3 |
0.9 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
5 |
1.51 |
|