TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00181

sequenceLengthmiRNA familysRNA IDtarget
AGUGAAGGGCAUAUAUACUCUAGU24NA S08410667NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 5 0.49
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 14 1.86
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 2 0.43
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 12 0.89
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 207 159.52
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 259 196.48
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 251 178.82
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 300 220.94
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 302 188.57
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 234 149.07
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 243 160.15
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 311 190.13
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 263 157.44
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 138 134.65
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 192 112.08
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 27 26.49
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 93 65.77
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 92 100.15
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 50 47.77
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 29 83.77
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 173 120.52
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 154 205.5
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 36 15.05
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 57 14.35
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 42 11.9
S0712 Solanum lycopersicum MicroTom fruit , mature green 51 13.05
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 11 5.3
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 26 21.6
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 16 9.07
S0708 Solanum lycopersicum MicroTom flower, open 78 24.07
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 86 22.58
S0373 Solanum lycopersicum Heinz 1706 fruit 1 0.3
S0372 Solanum lycopersicum Heinz 1706 flower 3 0.91
S0371 Solanum lycopersicum Heinz 1706 leaf 2 0.6

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00181

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch11 5282400 5282542 + ACUAGAGCAUGUAUACCCUU
UAUACUAACGGACAUUCACG
UGUCACAAUCUUAUCCACUG
AUUCGACAUUUAUCGAUGGA
UAAUAUUGCGCCACGUAUCU
CUAUUUAGUCUUCCGUUAGA
GUGAAGGGCAUAUAUACUCU
AGU
-56.00 NA structure
SL2.40ch06 38913893 38913751 - ACUAGAGCAUAUAUAUCUUU
UAUACUAACAAGCAUACACG
UGCCAUAAUCUUAUCCACCG
AUUCGAUAUUUAUCGAUUGA
UAAAAUUGUGUCACGUGUCC
GUAUUUAGUCUUCCGUUAGA
GUGAAGGGCAUAUAUACUCU
AGU
-46.30 NA structure