Tomato sRNA S08410667
| Sequence | Length | annotation |
| AGUGAAGGGCAUAUAUACUCUAGU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
14 |
1.86 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
12 |
0.89 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
207 |
159.52 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
259 |
196.48 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
251 |
178.82 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
300 |
220.94 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
302 |
188.57 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
234 |
149.07 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
243 |
160.15 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
311 |
190.13 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
263 |
157.44 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
138 |
134.65 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
192 |
112.08 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
27 |
26.49 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
93 |
65.77 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
92 |
100.15 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
50 |
47.77 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
29 |
83.77 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
173 |
120.52 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
154 |
205.5 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
36 |
15.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
57 |
14.35 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
42 |
11.9 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
51 |
13.05 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
26 |
21.6 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
16 |
9.07 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
78 |
24.07 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
86 |
22.58 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
|