 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00182
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AGACAAGCAAAUUGAAACGGACUG | 24 | NA | S06206896 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4 | 0.39 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 4 | 0.53 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 173 | 12.76 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 302 | 232.73 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 137 | 103.93 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 113 | 80.51 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 151 | 111.21 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 181 | 113.02 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 191 | 121.68 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 153 | 100.83 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 140 | 85.59 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 212 | 126.91 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 13 | 12.68 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 30 | 17.51 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 38 | 26.87 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 77 | 83.82 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 2 | 1.91 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 140 | 97.53 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 19 | 25.35 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 8 | 2.27 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 10 | 2.56 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 7 | 3.37 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 18 | 5.55 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 16 | 4.2 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 15 | 4.54 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 11 | 3.31 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00182
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch06 | 36014894 | 36015050 | + | CCUCUGUUUCAAUUUGUUUG UCUGGCUUUGACAUGACACA AAGUUUAGGAAAGUAAAAAA UACUUUUGAAUCUUGUGAUC UUAAACAUGUCACGUGAAAA GUUGAAAUUAAAGAGUUGCA AAAAAGGAAAGUAAGACAAG CAAAUUGAAACGGACUG |
-49.30 | NA | structure |
