Tomato sRNA S06206896
| Sequence | Length | annotation |
| AGACAAGCAAAUUGAAACGGACUG | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
4 |
0.39 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
4 |
0.53 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
173 |
12.76 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
302 |
232.73 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
137 |
103.93 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
113 |
80.51 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
151 |
111.21 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
181 |
113.02 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
191 |
121.68 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
153 |
100.83 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
140 |
85.59 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
212 |
126.91 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
13 |
12.68 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
30 |
17.51 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
38 |
26.87 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
77 |
83.82 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
2 |
1.91 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
140 |
97.53 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
19 |
25.35 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
8 |
2.27 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
10 |
2.56 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
7 |
3.37 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
18 |
5.55 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
16 |
4.2 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
7 |
2.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
15 |
4.54 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
11 |
3.31 |
|