TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00188

sequenceLengthmiRNA familysRNA IDtarget
UUUCGGACAUAGGUUGAGAGGGUA24NA S26186096click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 2 0.19
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 2 0.27
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 6 0.7
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 10 2.15
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 144 10.62
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 340 262.01
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 298 226.06
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 279 198.77
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 243 178.96
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 291 181.7
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 309 196.85
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 314 206.94
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 680 415.72
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 416 249.02
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 44 42.93
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 91 53.12
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 31 30.41
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 47 33.24
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 117 127.37
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 78 74.53
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 9 26
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 354 246.61
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 110 146.79
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 40 16.73
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 43 43.97
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 98 24.67
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 168 47.62
S0712 Solanum lycopersicum MicroTom fruit , mature green 126 32.24
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 88 42.39
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 35 29.08
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 27 15.31
S0708 Solanum lycopersicum MicroTom flower, open 127 39.19
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 61 16.01
S0373 Solanum lycopersicum Heinz 1706 fruit 10 2.99
S0372 Solanum lycopersicum Heinz 1706 flower 7 2.12
S0371 Solanum lycopersicum Heinz 1706 leaf 9 2.71

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00188

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch05 1507834 1507718 - UACCCCCUUAAUCUAUGCCA
GAAAUCUCAGAGACACUUAU
ACUAUACUAAGGGGGUAAUA
GGACCACAAUAUAGUAUAAG
UGUGUCUCUGAGAUUUCGGA
CAUAGGUUGAGAGGGUA		 -61.70 NA structure