Tomato sRNA S26186096
| Sequence | Length | annotation |
| UUUCGGACAUAGGUUGAGAGGGUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
2 |
0.19 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
6 |
0.7 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
10 |
2.15 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
144 |
10.62 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
340 |
262.01 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
298 |
226.06 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
279 |
198.77 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
243 |
178.96 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
291 |
181.7 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
309 |
196.85 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
314 |
206.94 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
680 |
415.72 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
416 |
249.02 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
44 |
42.93 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
91 |
53.12 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
31 |
30.41 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
47 |
33.24 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
117 |
127.37 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
78 |
74.53 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
9 |
26 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
354 |
246.61 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
110 |
146.79 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
40 |
16.73 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
43 |
43.97 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
98 |
24.67 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
168 |
47.62 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
126 |
32.24 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
88 |
42.39 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
35 |
29.08 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
27 |
15.31 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
127 |
39.19 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
61 |
16.01 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
10 |
2.99 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
7 |
2.12 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
9 |
2.71 |
|