TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00190

sequenceLengthmiRNA familysRNA IDtarget
UGUGGGGAAGAAGGGCAUUUUGGA24NA S24119684NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 1 0.1
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 7 0.93
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 2 0.43
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 51 3.76
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 12 9.25
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 3 2.28
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 12 8.55
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 14 10.31
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 12 7.49
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 7 4.46
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 10 6.59
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 15 9.17
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 5 2.99
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 18 17.56
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 3 1.75
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 6 5.89
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 9 6.37
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 7 7.62
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 3 2.87
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 1 2.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 7 4.88
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 15 20.02
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 9 3.76
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3 3.07
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 30 7.55
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 68 19.27
S0712 Solanum lycopersicum MicroTom fruit , mature green 17 4.35
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 74 35.65
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 318 264.18
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 743 421.28
S0708 Solanum lycopersicum MicroTom flower, open 18 5.55
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 22 5.78

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00190

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch02 45487052 45487175 + UGUAAAGUGUCCCUCUUCGC
CGCAUUUGUAGCAUCCCGCU
AUUCCUCCACCGCCUCCCUG
GCUACAUUCCCUUGCGAAAG
AAGGAGGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGA
-63.50 NA structure
SL2.40ch02 45483355 45483478 + UGUAAAGUGUCCUUCUUGUC
CGCAUUUGUAGCAUCCCGCU
CCUCCUCCACCGCCUCCUUG
GCUACAUUCCCUUGUGAAAG
AAGGAAGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGA
-64.00 NA structure