Tomato sRNA S24119684
| Sequence | Length | annotation |
| UGUGGGGAAGAAGGGCAUUUUGGA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
7 |
0.93 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
51 |
3.76 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
12 |
9.25 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
3 |
2.28 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
12 |
8.55 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
14 |
10.31 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
12 |
7.49 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
7 |
4.46 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
10 |
6.59 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
15 |
9.17 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
5 |
2.99 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
18 |
17.56 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
3 |
1.75 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
9 |
6.37 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
7 |
7.62 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
3 |
2.87 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1 |
2.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
7 |
4.88 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
15 |
20.02 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
9 |
3.76 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
30 |
7.55 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
68 |
19.27 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
17 |
4.35 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
74 |
35.65 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
318 |
264.18 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
743 |
421.28 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
18 |
5.55 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
22 |
5.78 |
|