TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00195

sequenceLengthmiRNA familysRNA IDtarget
AGGAAGACAUGAGGCAUUAGUAUG24NA S07391143NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1 0.22
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 450 346.78
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 150 113.79
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 156 111.14
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 157 115.63
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 367 229.16
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 518 329.99
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 314 206.94
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 445 272.05
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 672 402.27
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 127 123.91
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 647 377.7
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 146 143.22
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 338 239.04
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 65 70.76
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 4 3.82
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 1 2.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 594 413.8
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 499 665.88
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 1 1.02
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 4 1.01
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 5 1.42
S0712 Solanum lycopersicum MicroTom fruit , mature green 9 2.3
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 149 71.77
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 77 63.97
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 130 73.71
S0708 Solanum lycopersicum MicroTom flower, open 134 41.34
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 507 133.1
S0372 Solanum lycopersicum Heinz 1706 flower 1 0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00195

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch04 4907572 4907637 + AGGAAGACAUGAGGCAUUAG
UAUGUAUAUUGUGUAAAUUU
UAAAUACUAAUGCCUCAUGC
CUUCCU		 -33.80 NA structure