Tomato sRNA S07391143
| Sequence | Length | annotation |
| AGGAAGACAUGAGGCAUUAGUAUG | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
450 |
346.78 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
150 |
113.79 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
156 |
111.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
157 |
115.63 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
367 |
229.16 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
518 |
329.99 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
314 |
206.94 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
445 |
272.05 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
672 |
402.27 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
127 |
123.91 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
647 |
377.7 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
146 |
143.22 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
338 |
239.04 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
65 |
70.76 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
4 |
3.82 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1 |
2.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
594 |
413.8 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
499 |
665.88 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
1 |
1.02 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
4 |
1.01 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
5 |
1.42 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
9 |
2.3 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
149 |
71.77 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
77 |
63.97 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
130 |
73.71 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
134 |
41.34 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
507 |
133.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|