 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00197
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AUGGCAGAGACAAUACCUGAAUAU | 24 | NA | S11184180 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 26 | 1.92 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 69 | 53.17 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 127 | 96.34 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 28 | 19.95 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 53 | 39.03 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 57 | 35.59 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 80 | 50.96 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 60 | 39.54 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 89 | 54.41 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 63 | 37.71 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 735 | 717.14 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 874 | 510.22 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 931 | 913.25 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 839 | 593.37 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 407 | 443.06 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 849 | 811.18 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 278 | 803.07 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 17 | 11.84 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 29 | 38.7 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 8 | 3.35 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 19 | 4.78 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 15 | 3.84 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 17 | 8.19 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 10 | 5.67 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 60 | 18.51 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 90 | 23.63 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 10 | 3.03 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 9 | 2.71 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00197
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 49238938 | 49238752 | - | AUACUCAGGUAUUGUCUCUG CCAUGGGCGGCCAUUCGCUC UUUUAAUCCCCUCUUAUUGG CUCGCAGCCUCAAGGGAGAA UCGAACCCGUGACCUAUGGC UCCUUUACAUUCCCUUGAGG CAGCAAGCCAAUAAGAGGGG AUUAAAAGAGCGAAUGGCCG CCAAUGGCAGAGACAAUACC UGAAUAU |
-141.17 | NA | structure |
