TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S11184180

SequenceLengthannotation
AUGGCAGAGACAAUACCUGAAUAU24miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 26 1.92
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 69 53.17
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 127 96.34
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 28 19.95
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 53 39.03
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 57 35.59
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 80 50.96
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 60 39.54
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 89 54.41
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 63 37.71
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 735 717.14
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 874 510.22
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 931 913.25
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 839 593.37
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 407 443.06
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 849 811.18
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 278 803.07
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 17 11.84
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 29 38.7
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 8 3.35
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 5 5.11
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 19 4.78
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 3 0.85
S0712 Solanum lycopersicum MicroTom fruit , mature green 15 3.84
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 17 8.19
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 11 9.14
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 10 5.67
S0708 Solanum lycopersicum MicroTom flower, open 60 18.51
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 90 23.63
S0373 Solanum lycopersicum Heinz 1706 fruit 3 0.9
S0372 Solanum lycopersicum Heinz 1706 flower 10 3.03
S0371 Solanum lycopersicum Heinz 1706 leaf 9 2.71

S11184180 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc05g031610 1 24 + click here