Tomato sRNA S00324760
| Sequence | Length | annotation |
| AAAAGCUGACGGCGUUAGAUUGAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
15 |
1.11 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
131 |
100.95 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
53 |
40.21 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
62 |
44.17 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
65 |
47.87 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
79 |
49.33 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
71 |
45.23 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
62 |
40.86 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
83 |
50.74 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
76 |
45.49 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
104 |
101.47 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
151 |
88.15 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
77 |
75.53 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
171 |
120.94 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
75 |
81.65 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
144 |
137.59 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
71 |
205.1 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
62 |
43.19 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
44 |
58.72 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
5 |
5.11 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
16 |
4.03 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
32 |
9.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
45 |
11.51 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
15 |
7.23 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
22 |
18.28 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
18 |
10.21 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
108 |
33.32 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
210 |
55.13 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
|