Tomato sRNA S02673882
| Sequence | Length | annotation |
| AAGCUGACGGCAUUAGAUUGAUAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1 |
0.07 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
14 |
10.79 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
33 |
25.03 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
21 |
14.96 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
18 |
13.26 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
20 |
12.49 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
12 |
7.64 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
15 |
9.89 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
27 |
16.51 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
20 |
11.97 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
38 |
37.08 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
49 |
28.6 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
29 |
28.45 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
15 |
10.61 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
30 |
32.66 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
49 |
46.82 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
48 |
138.66 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
16 |
11.15 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
17 |
22.69 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
15 |
6.27 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
15 |
3.78 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
24 |
6.8 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
19 |
4.86 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
16 |
13.29 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
10 |
5.67 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
16 |
4.94 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
53 |
13.91 |
|