Tomato sRNA S02673911
| Sequence | Length | annotation |
| AAGCUGACGGCGUUAGAUUGAUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3 |
0.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
4 |
0.47 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1 |
0.07 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
77 |
59.34 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
39 |
29.59 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
28 |
19.95 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
63 |
46.4 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
96 |
59.94 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
61 |
38.86 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
66 |
43.5 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
68 |
41.57 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
72 |
43.1 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
140 |
136.6 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
212 |
123.76 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
173 |
169.7 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
146 |
103.26 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
48 |
52.25 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
68 |
64.97 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
48 |
138.66 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
20 |
13.93 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
77 |
102.75 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
48 |
20.07 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
8 |
8.18 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
35 |
8.81 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
32 |
9.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
103 |
26.35 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
22 |
10.6 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
13 |
10.8 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
38 |
11.72 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
64 |
16.8 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|