Tomato sRNA S03156022
| Sequence | Length | annotation |
| AAGUUGACGGCGUUAGAUUGAUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
10 |
0.74 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
180 |
138.71 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
112 |
84.96 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
64 |
45.6 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
116 |
85.43 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
186 |
116.14 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
105 |
66.89 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
131 |
86.34 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
124 |
75.81 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
144 |
86.2 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
181 |
176.6 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
265 |
154.7 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
155 |
152.05 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
192 |
135.79 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
151 |
164.38 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
224 |
214.02 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
256 |
739.51 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
70 |
48.76 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
200 |
266.89 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
185 |
77.36 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
32 |
32.72 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
180 |
45.31 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
198 |
56.12 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
131 |
33.52 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
37 |
17.82 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
18 |
14.95 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
23 |
13.04 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
66 |
20.36 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
124 |
32.55 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|