Tomato sRNA S04789486
| Sequence | Length | annotation |
| ACAUGUGGGACCAGCGCGGAGUGA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
6 |
0.7 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
21 |
4.52 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
5918 |
436.51 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
1 |
0.74 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
1 |
0.62 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1 |
1.33 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
9 |
2.27 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
11 |
3.12 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
9 |
2.3 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
6 |
1.8 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4 |
1.21 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
5 |
1.51 |
|