Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AGAAUCUUGAUGAUGCUGCAU	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1752	170.72
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	464	61.5
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1827	213.43
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	6	1.29
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	7596	560.28
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	8	3.35
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	26	6.54
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	5	1.42
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	21	5.37
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	17	8.19
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	8	4.54
S0708	Solanum lycopersicum	MicroTom	flower, open	75	23.14
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	54	14.18
S0373	Solanum lycopersicum	Heinz 1706	fruit	4129	1235.87
S0372	Solanum lycopersicum	Heinz 1706	flower	2160	653.71
S0371	Solanum lycopersicum	Heinz 1706	leaf	4461	1344.28