Tomato sRNA S06454254
| Sequence | Length | annotation |
| AGAGACGCACUUAUACUAUACUAA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
5 |
0.37 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
23 |
17.72 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
12 |
9.1 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
20 |
14.25 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
17 |
12.52 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
23 |
14.36 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
26 |
16.56 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
8 |
5.27 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
36 |
22.01 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
27 |
16.16 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
33 |
32.2 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
73 |
42.62 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
31 |
30.41 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
33 |
23.34 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
45 |
48.99 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
40 |
38.22 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
65 |
187.77 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
31 |
21.6 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
31 |
41.37 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
25 |
6.29 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
8 |
2.27 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
17 |
4.35 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
9 |
4.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
8 |
6.65 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
15 |
8.51 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
68 |
20.98 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
82 |
21.53 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
|