Tomato sRNA S06456488
| Sequence | Length | annotation |
| AGAGACGGACUUAUACUAUACUAA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
15 |
1.11 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
124 |
51.85 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
18 |
18.41 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
152 |
38.26 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
179 |
50.73 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
170 |
43.49 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
62 |
29.87 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
67 |
55.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
89 |
50.46 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
345 |
106.45 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
332 |
87.16 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
7 |
2.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
6 |
1.81 |
|