Tomato sRNA S07846780
| Sequence | Length | annotation |
| AGGGAUUGUAGGCAGAGAGAUGG | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
115 |
8.48 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
107 |
82.46 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
27 |
20.48 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
70 |
49.87 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
122 |
89.85 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
86 |
53.7 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
57 |
36.31 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
89 |
58.66 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
147 |
89.87 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
115 |
68.84 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
12 |
11.71 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
20 |
11.68 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
11 |
10.79 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
30 |
21.22 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
38 |
41.37 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
23 |
21.98 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
16 |
46.22 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
67 |
46.67 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
77 |
102.75 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
164 |
68.58 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
140 |
143.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
276 |
69.47 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
687 |
194.71 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
398 |
101.82 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
711 |
342.49 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1367 |
1135.62 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2649 |
1501.99 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
248 |
76.52 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
623 |
163.55 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
|