Tomato sRNA S08637549
| Sequence | Length | annotation |
|---|
| AGUUGACGGCGUUAGAUUGAUA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
24 |
18.49 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
19 |
14.41 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
11 |
7.84 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
12 |
8.84 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
23 |
14.36 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
5 |
3.19 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
11 |
7.25 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
20 |
12.23 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
23 |
13.77 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
11 |
10.73 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
19 |
11.09 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
20 |
14.14 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
17 |
18.51 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
42 |
40.13 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
35 |
101.11 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
14 |
9.75 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
15 |
20.02 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
40 |
16.73 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
7 |
7.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
40 |
10.07 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
45 |
12.75 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
58 |
14.84 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
16 |
7.71 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
22 |
12.47 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
42 |
12.96 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
86 |
22.58 |
|
