Tomato sRNA S08637551
| Sequence | Length | annotation |
| AGUUGACGGCGUUAGAUUGAUACA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
312 |
130.47 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
75 |
76.69 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
440 |
110.75 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1041 |
295.04 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1013 |
259.17 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
73 |
35.16 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
27 |
22.43 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
195 |
110.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1583 |
488.43 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
2298 |
603.29 |
|